1, RT-PCR of total RNAs isolated from 293T cells revealed detectable transcripts of ENaC subunits (, , and ) and their regulators SGK1, MR, hDot1L, AF9, and AF17 (observe below). ENaC subunits and their transcriptional regulators and reduced benzamil-sensitive Na+currents. AF17 overexpression caused the opposite effects, accompanied by redirection of Dot1a from your nucleus to the cytoplasm and reduction in histone H3 K79 methylation. The nuclear export inhibitor leptomycin B blocked the effect of AF17 overexpression on H3 K79 hypomethylation. RNAi-mediated knockdown of AF17 yielded nuclear enrichment of Dot1a and histone H3 K79 hypermethylation. BIO-acetoxime As with AF9, AF17 displays nuclear and cytoplasmic co-localization with Sgk1. Therefore, AF17 competes with AF9 to bind Dot1a, decreases Dot1a nuclear expression by possibly facilitating its nuclear export, and relieves Dot1aAF9-mediated repression of -ENaCand other target genes. == Introduction == Failure of Na+homeostasis contributes to hypertension, cardiovascular disease, and respiratory diseases such as cystic fibrosis (1). The importance of the epithelial Na+channel (ENaC)3in the regulation of salt homeostasis and blood pressure is demonstrated by the association of gain- and loss-of-function mutations in its subunits with genetic hypertensive and hypotensive diseases, such as Liddle syndrome (2) and pseudohypoaldosteronism type 1 (3). ENaC consists of three partially homologous subunits (, , and ), and their expression around the cell surface constitutes the rate-limiting step in active Na+and fluid absorption in the apical membrane of salt-absorbing epithelia. Aldosterone treatment or hyperaldosteronism caused by Na+limitation induces -ENaCtranscription in the aldosterone-sensitive distal nephron. In these cells synthesis of -ENaC is usually believed to be the rate-limiting step in Na+channel formation. As a major regulator of epithelial Na+absorption, aldosterone imposes a tight and complex regulation of ENaC at multiple levels including transcription, trafficking to the Rabbit polyclonal to Caldesmon cell membrane, and degradation and functions at least partially through -ENaCinduction in the renal collecting duct (4,5). We recently recognized and characterized a new aldosterone signaling network involving the murine disruptor of telomeric silencing BIO-acetoxime splice variant a (Dot1a) (6), putative transcription factor AF9, and serum- and glucocorticoid-inducible kinase isoform 1 (Sgk1). Under basal conditions, Dot1a and AF9 form a repression complex that binds directly or indirectly to the -ENaCpromoter, catalyzes H3 K79 hypermethylation at the promoter, and represses -ENaCtranscription. Aldosterone relieves this repression by inhibiting Dot1a and AF9 expression and by weakening their conversation via Sgk1-mediated AF9 phosphorylation (79). Because Dot1a and AF9 are highly conserved and widely expressed and appear to be involved in transcriptional regulation of other genes (7,8), we hypothesized that this new aldosterone signaling network exists in human cells and that additional protein-protein interactions might regulate the Dot1aAF9 complex and, thus, the transcription of ENaC and their transcriptional regulators in an aldosterone-dependent or -impartial manner. Here, we statement the characterization and use of human embryonic kidney (HEK) 293T cells as a model system to study this new aldosterone-signaling network. We provide evidence showing a novel protein-protein conversation between Dot1a and AF17 that, like AF9, is usually a mixed lineage leukemia (MLL) fusion partner involved in acute myeloid leukemia (10,11). We also define AF17 as a new regulator of Dot1a H3 K79 methyltransferase activity and, thus, basal transcription of -ENaCand other aldosterone-regulated genes. == EXPERIMENTAL PROCEDURES == == BIO-acetoxime == == == == Reagents == LipofectamineTM2000 reagent (Invitrogen), Millicell inserts (12 mm in diameter, 0.45 mpore size, Millipore), and antibodies against dimethyl histone H3 K79, dimethylated histone H3 K9 (Upstate), trimethyl histone H3 K79 (Abcam), GFP, red fluorescence protein (RFP; Clontech), and FLAG (Sigma) were purchased and used according to the manufacturer’s instructions. pGL3Zeocin-1.3-ENaC, pDsRedmonomer-V5, and pCDNA3.1 derivatives expressing untagged Dot1a and constructs expressing numerous Dot1a mutants as GAL4 BD fusions for yeast or mammalian two-hybrid assays as well as those for GFP-Dot1a or glutathioneS-transferase (GST)-Dot1a fusions have been explained previously (69). Human AF17 and its mouse counterpart are equally competent for interacting with Dot1a (observe below). For simplicity, AF17 was used to designate these two proteins throughout the manuscript unless normally stated. pCDNA-AF17 and pFLAG-AF17 expressing untagged or FLAG-tagged human AF17 were kindly provided by Yoichi Furukawa (12). A 3.2-kb EcoRI/XhoI fragment encoding full-length human AF17 was isolated from pCDNA-AF17 and cloned into pGADT7, pCMV-AD, pGEX6P-1, and pDsRed-monomer-V5 at EcoRI/XhoI sites for expression of AF17 as GAL4 AD, GST, or RFP fusions, respectively. The cDNA place expressing mouse AF17 aa 635786 (referred to as AF17 635786 hereafter) was released from your pGAD10-based isolates and cloned into pGADT7 at the EcoRI site in either forward or reverse orientations. The former was partially digested with EcoRI/XhoI to release the place. BIO-acetoxime The place was subsequently cloned into BIO-acetoxime numerous vectors for expression of AF17 635786 as FLAG, GST, or GAL4 AD fusions. Two mouse AF17 target sequences (siRNAi#10, CCCGCTGGTCTACTGCGAT, encoding aa 2126; siRNAi#11, AAGCTTGCTATGGCATCGTCC, encoding aa 3642) were identical.